Publique en esta revista
Información de la revista
Vol. 68. Núm. 5.
Páginas 474-480 (Mayo 2008)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Visitas
7311
Vol. 68. Núm. 5.
Páginas 474-480 (Mayo 2008)
ORIGINALES
DOI: 10.1157/13120045
Acceso a texto completo
Concentración de vitamina B12 en suero en población puberal de la Comunidad de Madrid
Serum vitamin b12 levels in an adolescent population in madrid
Visitas
7311
R. Gil Prietoa,
Autor para correspondencia
ruth.gil@urjc.es

Dra. R. Gil Prieto. Departamento de Ciencias de la Salud. Universidad Rey Juan Carlos. Avda. de Atenas, s/n. 28922 Alcorcón. Madrid. España.
, J. Esteban Hernándeza, V. Hernández Barrera. Madrid.a, B. Canob, M. de Oyab, A. Gil de Miguela
a Área de Medicina Preventiva y Salud Pública. Departamento de Ciencias de la Salud. Universidad Rey Juan Carlos. Alcorcón. España
b Laboratorio de Lípidos. Fundación Jiménez Díaz de Madrid. Madrid. España
Este artículo ha recibido
7311
Visitas
Información del artículo
Resumen
Texto completo
Descargar PDF
Estadísticas
Figuras (3)
Mostrar másMostrar menos
Tablas (3)
Tabla 1. Percentiles de vitamina B12 sérica en adolescentes*
Tabla 2. Percentiles de vitamina B12 sérica en adolescentes por genotipo C677T de la MTHFR*
Tabla 3. Concentración de vitamina B12 sérica por genotipo de la enzima MTHFR
Mostrar másMostrar menos
Introducción

Disponer de datos sobre la concentración de vitamina B12 en suero en niños es imprescindible para establecer unos percentiles que permitan realizar comparaciones entre regiones o países y poder plantear la suplementación de la dieta con vitaminas del grupo B como prevención secundaria frente a las enfermedades cardiovasculares.

Material y métodos

Se realizó un estudio epidemiológico descriptivo de tipo transversal, con el fin de estimar las concentraciones séricas de vitamina B12 en la población escolar entre 13 y 15 años en la Comunidad de Madrid. Se realizó una determinación de folato y vitamina B12 en las muestras de sangre obtenidas en ayunas. Se determinó el genotipo C677T de la enzima metilentetrahidrofolato reductasa por reacción en cadena de la polimerasa (PCR).

Resultados

Las concentraciones medias de vitamina B12 obtenidos en nuestro estudio fueron de 503 pmol/l; intervalo de confianza del 95% (IC 95%) (478-528 pmol/l). La mediana fue de 471 pmol/l; rango intercuartílico (337-632 pmol/l).

No se encontraron diferencias estadísticamente significativas por edad o genotipo C677T. La concentración sérica de vitamina B12 fue significativamente mayor en las mujeres. La prevalencia de valores deficitarios de vitamina B12 (< 224 pmol/l) fue del 6% en varones y del 4% en mujeres.

Conclusiones

Se presentan valores de referencia de las concentraciones de vitamina B12 sérica en población adolescente. La prevalencia de déficit de vitamina B12 es mayor en varones.

Palabras clave:
Vitamina B12
Adolescentes
España
Introduction

Serum vitamin B12 concentration levels in children are essential to establish values in order to compare different regions or countries, and for considering e the possibility of supplementing diets with group B vitamins as a secondary prevention against cardiovascular diseases.

Material and methods

A cross-sectional epidemiological study was carried out to asses serum vitamin B12 levels in school children, 13-15 years of age, in Madrid. Folate and vitamin B12 vitamin determinations were performed on fasting blood samples. Genotype C677T of methylentetrahydrofolate reductase (MTHFR) enzyme was determined by PCR.

Results

The mean vitamin B12 level obtained in our study was 503 pmol/l; CI 95% CI (478-528 pmol/l). The median was 471 pmol/l; interquartile range (IR) (337-632 pmol/l).

No statistically significant differences were found by age or C677T genotype for MTHFR. Serum vitamin B12 concentrations were significantly higher in females. Prevalence of vitamin B12 deficiency (< 224 pmol/l) was 6% in males and 4% in females.

Conclusions

Reference values for serum vitamin B12 concentrations in an adolescent population are presented. Prevalence of vitamin B12 deficiencies is higher in males.

Key words:
Vitamin B12
Adolescents
Spain
Texto completo
INTRODUCCIÓN

Diversos estudios epidemiológicos han comprobado que a medida que avanza la edad, las concentraciones de vitamina B12 disminuye en la población general1,2. La vitamina B12 se obtiene a través de los productos animales ingeridos en la dieta, y su deficiencia puede originar complicaciones importantes, como anemia megaloblástica, neuropatías y trastornos neuropsiquiátricos3,4. El proceso de absorción de la vitamina B12 es complejo. Las enzimas digestivas del estómago liberan la vitamina B12 de su unión a proteína, y la vitamina B12 libre se une a un factor intrínseco, producido por las células parietales, para formar el complejo IF-B12, absorbido en el intestino.

Este proceso hace que se pueda producir déficit de vitamina B12 no sólo por una ingesta insuficiente, sino también por problemas digestivos o de malabsorción intestinal1,5.

Una buena concentración de vitamina B12 es esencial para el buen funcionamiento de multitud de procesos metabólicos, entre otros, el metabolismo de la homocisteína.

La homocisteína se metaboliza a metionina vía remetilación o a cisteína a través de la transulfuración en el hígado. Durante la transulfuración, dependiente de la vitamina B6, la homocisteína se cataboliza irreversiblemente a cisteína gracias a la acción de la enzima cistationinap -sintetasa y en presencia de serina. La mayor parte de la homocisteína es remetilada regenerando metionina, principalmente por la acción de la metionina sintetasa, enzima que depende de la acción como cofactor de la metilcobalamina (vitamina B12) y del folato, en forma de S-metil-tetrahidrofolato, como donante de grupos metilo, que es producido gracias a la acción de la enzima metilentetrahidrofolato reductasa (MTHFR). Cuando estas reacciones se alteran, la homocisteína se acumula y se excreta a la sangre6. La 27.a Conferencia de Bethesda en 1996 propuso la hiperhomocisteinemia como uno de los nuevos factores de riesgo cardiovascular7,8, aunque todavía existe una gran controversia en la aceptación de la hiperhomocisteinemia como factor de riesgo cardiovascular y en la utilidad del tratamiento con suplementos vitamínicos como prevención secundaria.

En 1994 se describieron nueve mutaciones del gen que codifica para la MTHFR. Se identificó una variante polimórfica en el nucleótido 677 en la que se sustituye una citosina por una timina, lo que lleva a un cambio del aminoácido alanina por valina9.

La mutación C677T de la MTHFR, es la causa más frecuente de hiperhomocisteinemia moderada debida a factores genéticos. Se ha encontrado un efecto directo del genotipo TT sobre la concentración de homocisteína, al verse disminuida en un 50 % la actividad enzimática de la MTHFR en individuos con esta mutación10. Este polimorfismo está presente en su forma homocigota en el 5-18 % de la población11.

La mayor parte de las enfermedades cardiovasculares se producen por alguna combinación de los factores “tradicionales” de riesgo cardiovascular: el tabaquismo, la hipercolesterolemia, la hipertensión arterial, la obesidad, el estilo de vida sedentario y la diabetes. Estos factores de riesgo explican la mayor parte de la etiología y la epidemiología de la enfermedad cardiovascular, pero no su totalidad12. Hay un grupo no despreciable de pacientes que padecen la enfermedad sin haber estado expuestos a ninguno de los factores clínicamente relevantes13,14. Esto plantea la necesidad de investigar nuevos factores de riesgo de naturaleza distinta a los ya establecidos, que permitan desarrollar estrategias de prevención primaria y secundaria.

En nuestro país apenas se dispone de datos sobre la concentración de vitamina B12 en la población general y, aún menos, en niños. Estos datos son imprescindibles para establecer unos percentiles que permitan realizar comparaciones entre regiones o países con el fin de poder llevar a cabo estudios fiables que nos ayuden a estudiar una posible asociación con la enfermedad coronaria, puesto que distintos factores de riesgo cardiovascular en población infantil podrían estar relacionados con la aparición de la enfermedad cardiovascular en la edad adulta.

PACIENTES Y MÉTODOS

Se realizó un estudio epidemiológico descriptivo de tipo transversal, con el fin de estimar las concentraciones séricas de vitamina B12 en la población escolar de entre 13 y 15 años en la Comunidad de Madrid. En este estudio se realizó un muestreo aleatorio, estratificado y por conglomerados de los centros escolares en la provincia de Madrid. Se seleccionaron los centros escolares, a partir de los datos de la Delegación Provincial de Educación que incluye el total de los colegios de cada provincia. Los colegios se seleccionaron en estratos que asegurasen la representación de diferencias socioeconómicas.

Se incluyeron en el estudio 313 sujetos de ambos sexos, mayores de 13 años y escolarizados en la Comunidad de Madrid en los cursos de 2o y 3o de ESO. Debían presentar consentimiento informado firmado por los padres y/o tutores. Se excluyeron del estudio todos aquellos sujetos que presentaron algún tipo de patología aguda o crónica que pudiera afectar a las variables de interés.

Para cada sujeto se recogió información sobre edad y sexo. En el caso de las niñas, se recogió información sobre la aparición o no de la menarquia. Se realizó una extracción de sangre venosa antecubital y se almacenó a 4°C tras centrifugarlas a 3.500rpm durante 6min.

El protocolo de este estudio fue evaluado por el comité ético de investigación clínica de la Fundación Jiménez Díaz. El conjunto de la investigación ha cumplido las salvaguardas éticas de la Declaración de Helsinki, sus actualizaciones posteriores y la legislación española sobre investigación clínica en humanos.

Determinación de vitamina B12

Se realizó una determinación de vitamina B12 en la muestra de sangre obtenida en ayunas15 mediante un ensayo de fijación in vitro para la determinación cuantitativa en suero humano. Este inmunoensayo de electroquimioluminiscencia se emplea en el módulo de inmunoanálisis Elecsys MODULAR ANALYTICS E170 de Roche. La vitamina B12 de la muestra compite con la vitamina B12 añadida marcada con biotina por los puntos de fijación del complejo factor intrínseco marcado con rutenio.

Determinación del genotipo C677T de la MTHFR

La sustitución de una citosina por una timina en la posición nucleotídica 677, convierte el aminoácido alanina en valina (genotipo normal = CC, genotipo heterocigoto con un alelo mutado = CT, genotipo mutado homocigoto, con los dos alelos mutados = TT). El ADN se amplificó mediante reacción en cadena de la polimeresa (PCR) en un termociclador (PTC-100) utilizando los nucleótidos:

  • Forward: 5′TGAAGGAGAAGGTGTCTGCGGGA 3′.

  • Reverse: 3′AGGACGGTGCGGTGAGGAGGTG 3′.

El producto de esta reacción se digirió con la enzima de restricción HinfI. Los fragmentos se separaron en gel de poliacrilamida no desnaturalizante.

Determinación de folato

Se realizó una determinación de folato en las muestra de sangre obtenidas en ayunas mediante un ensayo de fijación in vitro para la determinación cuantitativa de folato en suero humano en el módulo de inmunoanálisis Elecsys MODULAR ANALYTICS E170 de Roche16. Este test está basado en un principio de test competitivo que utiliza proteínas fijadoras naturales específicas del folato. El folato de la muestra compite con el folato biotinilado añadido por ocupar los puntos de fijación de la proteína fijadora específica del folato marcada con rutenio.

Análisis estadístico

Se realizó un análisis descriptivo utilizando las medidas de centralización y dispersión (medias o medianas si la distribución fue asimétrica), acompañadas con sus correspondientes IC 95 % en las variables cuantitativas y la distribución de frecuencias (prevalencias y proporciones con IC 95 %) para las variables cualitativas. Este análisis se realizó estratificando por sexo, presencia de menstruación en las mujeres, grupo de edad y genotipo C677T de la enzima MTHFR.

Se comprobó la normalidad de la variable vitamina B12 en suero mediante el test de Kolmogorov-Smirnov. Al no seguir una distribución normal, se utilizaron pruebas no paramétricas.

Además de la normalidad, se estudió la homocedasticidad u homogeneidad de varianzas mediante la prueba de Levene.

Con el fin de establecer la magnitud de la relación lineal de la vitamina B12 con las variables cuantitativas antropométricas y bioquímicas, se realizó un análisis de correlación de Spearman.

La técnica empleada para la comparación fue la prueba de x2 de Pearson (cuando la frecuencia esperada fue menor de 5, se utilizó la prueba de Fisher). Para la comparación de medias se utilizaron la prueba U de Mann–Whitney y para variables con más de dos categorías la prueba Kruskal-Wallis. En todos los contrastes de hipótesis para estimar las diferencias, asociaciones y relaciones se consideraron significativas cuando el valor de p fue menor de 0,05.

Para el análisis estadístico de los datos se utilizó el programa SPSS (Stadistical Package for Social Sciences) versión 13.0.

RESULTADOS

La concentración de vitamina B12 sérica sigue una distribución no normal en la muestra, desplazada hacia los niveles más altos (fig. 1). Las concentraciones medias de vitamina B12 obtenidas en nuestro estudio fueron de 503 pmol/l; IC 95 % 478–545 pmol/l. La mediana fue de 471 pmol/l; rango intercuartílico 337–632 pmol/l.

Figura 1.

Distribución de los valores de vitamina B12 en suero (pmol/l).

(0,05MB).

Todos los sujetos tenían concentraciones de vitamina B12 por encima de los puntos de corte definidos en la literatura médica17, por lo que se decidió definir déficit vitamínico como aquellos valores séricos inferiores o iguales al percentil 5, es decir, a 224 pmol/l. Debido al tamaño de muestra tan reducido (n = 15) por debajo del percentil 5, y teniendo en cuenta el carácter continuo del riesgo de déficits vitamínicos, se tomó como referencia el percentil 25, es decir, 337 pmol/l para conseguir la potencia estadística necesaria en algunos test.

En la tabla 1 se presentan los valores de vitamina B12 sérica en la muestra estudiada, distribuidos por deciles.

Tabla 1.

Percentiles de vitamina B12 sérica en adolescentes*

Percentil  10  20  30  40  50  60  70  80  90 
Total  252,5  309,0  369,0  418,2  470,8  514,9  590,3  677,8  789,9 
Varones  243,4  290,2  333,4  382,7  450,2  485,1  545,3  602,8  687,5 
Mujeres  265,2  335,7  382,7  431,1  487,4  568,0  649,9  718,0  844,9 
13 años  243,1  295,4  340,8  401,8  482,2  551,4  615,4  694,6  808,9 
14 años  266,8  327,2  376,2  419,2  467,8  509,2  572,8  683,9  808,3 
15 años  252,8  358,2  419,7  450,9  475,3  506,5  565,6  607,8  675,1 
*

Concentración en pmol/l.

La media en varones fue de 462 pmol/l (IC 95 %: 427–496 pmol/l), significativamente menor que en mujeres, que fue de 538 pmol/l (IC 95 % 501–574 pmol/l), las medianas fueron de 450 y 487 pmol/l, respectivamente (tabla 1).

La media de los valores de vitamina B12 sérica en las mujeres que ya habían tenido su primera menstruación fue de 548 pmol/l (IC 95 %: 509–587 pmol/l), mientras que en las niñas que todavía no la habían tenido fue de 450 pmol/l (IC 95 %; 365–534 pmol/l).

La prevalencia de valores deficitarios de vitamina B12 (percentil 5 < 224 pmol/l) fue del 4,8 %, el 5,6 % en hombres y el 4,1 % en mujeres. Teniendo en cuenta el primer cuartil (P25 < 337 pmol/l), fue del 24,6 %; el 30,3 % en hombres y el 19,9 % en mujeres (fig. 2).

Figura 2.

Prevalencia del déficit de vitamina B12 en función del sexo y los percentiles (A P5; B, P25).

(0,09MB).

La media de las concentraciones de vitamina B12 en suero por edad fueron de 505 pmol/l (IC 95%: 469–540 pmol/l), 518 pmol/l (IC 95 %: 469–567 pmol/l) y 466 pmol/l (IC 95 %: 419–512 pmol/l) a los 13, 14 y 15 años, respectivamente, las medianas fueron muy similares entre los grupos (tabla 1).

Los valores medios de la concentración sérica de vitamina B12 en función de la mutación del genotipo C677T de la enzima metilentetrahidrofolato reductasa al pasar de CC → CT → TT fueron de 502 pmol/l; IC 95 %: 458–545 pmol/l en CC, 498 pmol/l; IC 95 %: 460–535 pmol/l en CT y 523 pmol/l; IC 95 %: 466–582 pmol/l en TT, respectivamente (tablas 2 y 3) (fig. 3).

Tabla 2.

Percentiles de vitamina B12 sérica en adolescentes por genotipo C677T de la MTHFR*

Percentil  10  20  30  40  50  60  70  80  90 
CC  254,7  304,4  364,6  400,0  464,7  519,7  589,1  677,5  793,2 
CT  230,1  303,0  349,7  405,9  458,0  500,2  588,9  682,9  810,7 
TT  273,4  366,6  426,9  466,1  502,2  552,8  617,9  670,6  775,1 

CC: genotipo homocigoto no mutado; CT: genotipo heterocigoto; MTHFR: metilentetrahidrofolato reductasa; TT: genotipo homocigoto mutado.

*

Concentración en pmol/l.

Tabla 3.

Concentración de vitamina B12 sérica por genotipo de la enzima MTHFR

Genotipo C677T MTHFR  Media  IC 95 %  Mediana  RI 
CC  502  458-545  465  336-617 
CT  498  460-535  458  325-625 
TT  524  466-582  502  387-640 

p < 0,05. Concentración en pmol/l.

CC: genotipo homocigoto no mutado; CT: genotipo heterocigoto;

IC 95 %: intervalo de confianza del 95 %; MTHFR: Metilentetrahidrofolato reductasa; RI: rango intercuartílico; TT: genotipo homocigoto mutado.

Figura 3.

Percentiles de vitamina B12 en función del genotipo C677T de la enzima metilentetrahidrofolato reductasa. CC: genotipo homocigoto no mutado; CT: genotipo heterocigoto mutado; TT: genotipo homocigoto mutado.

(0,08MB).

No se encontraron diferencias estadísticamente significativas por edad, presencia o ausencia de menstruación ni genotipo C677T de la enzima metilentetrahidrofolato reductasa.

Al estudiar la fuerza de la asociación entre las concentraciones séricas de vitamina B12 y las distintas variables estudiadas, se observa cómo las concentraciones de vitamina B12 aumenta significativamente con la concentración sérica de folato, con los que tiene una correlación de: rho = 0,96; p < 0,05.

La concentración de vitamina B12 se asocia de forma positiva cada vez con más intensidad con los valores de folato en suero a medida que aumenta la edad (rho = 0,344 a los 13 años, rho = 0,393 a los 14 años y rho = 0,510 a los 15 años de edad; p < 0,01).

DISCUSIÓN

El establecimiento de unos percentiles de las concentraciones séricas de vitamina B12 que puedan utilizarse como referencia en población adolescente occidental resulta de gran utilidad a la vista de la falta de valores de referencia o consenso internacional. Pese a no observarse déficits vitamínicos importantes, parece que el carácter continuo del riesgo de distintos factores implicados en la enfermedad cardiovascular en el adulto obliga a olvidar el concepto de un umbral por encima o debajo del cual podamos considerar a un paciente como enfermo o sano y a plantearse un estudio exhaustivo de todas aquellas variables ambientales en población infantil que pueden estar relacionados con la aparición de la enfermedad cardiovascular en la edad adulta.

Las concentraciones medias de vitamina B12 obtenidas en nuestro estudio fueron de 503 pmol/l; IC 95 %: 478–528 pM. La mediana fue de 471 pmol/l; rango intercuartílico (337–632 pmol/l), algo superior a los 408 pM que se encontraron en niños griegos18 y a los 396 pmol/l en niños y adolescentes españoles19. En un trabajo realizado en el año 1994 en población española se encontró que el intervalo de referencia de la concentración de vitamina B12 entre los percentiles 5 y 95 en adolescentes fue de 242–875 pmol/l20, coherente con nuestros resultados: percentil 5–95 (224–876 pmol/l).

En el presente trabajo se definió deficiencia de vitamina B12 como aquellos valores séricos inferiores o iguales al percentil 5, es decir, a 224 pmol/l.

La prevalencia de valores deficitarios de vitamina B12 es del 4,8 % y se encuentran valores mayores en varones (5,6 %) que en mujeres (4,1 %). Estas diferencias en la prevalencia por sexo, se hacen significativas al tomar para el cálculo estadístico el percentil 25, con el fin de aumentar el tamaño muestral lo suficiente para tener la potencia estadística necesaria. La deficiencia de vitamina B12 en niños y adolescentes turcos de 7 a 17 años es del 5,9 %, pero no se especifica cómo definen deficiencia20. En población pediátrica china las deficiencias de vitamina B12, definida como concentraciones menores a 147,6 pM, afectan al 4,5%15.

Distintos estudios epidemiológicos muestran un descenso en la concentración de los factores vitamínicos con la edad, aumentando la fuerza de la asociación entre la concentración baja de vitaminas y la homocisteína. Como en tantos otros procesos enzimáticos, a concentraciones saturantes de sustrato, la actividad enzimática del ciclo metabólico es óptima, pero al disminuir con la edad la concentración de folato y vitaminas del grupo B de reserva existentes en la infancia, se puede ver comprometida la actividad enzimática de la MTHFR. Al disminuir los niveles de sustrato se acumula homocisteína y se hace más importante la asociación lineal entre el folato sérico y la vitamina B12, que actúa como cofactor vitamínico necesario en la síntesis del folato.

En nuestro estudio no se observa una disminución de las concentraciones de vitamina B12 con la edad, aunque puede deberse al estrecho intervalo de edad analizado22.

En países occidentales los déficits vitamínicos son poco frecuentes, pero en poblaciones con importantes carencias vitamínicas, la concentración de homocisteína plasmática se eleva hasta alcanzar prevalencias de hiperhomocisteinemia ajustadas por edad del 73 % en hombres y del 41 % en mujeres, tal como demuestra una reciente investigación llevada a cabo en Irán23.

Algunos autores defienden que en edad pediátrica la homocisteína puede estar más influida por factores bioquímicos que genéticos19,20. Manteniendo toda la vida una buena concentración vitamínica, que puede obtenerse a partir de una dieta rica o de suplementos vitamínicos, se podría enmascarar el efecto perjudicial en el riesgo cardiovascular del polimorfismo parcial o totalmente mutado.

Los resultados de un estudio en adultos de la comunidad autónoma de Canarias muestran asociación de la homocisteinemia con la vitaminas B12 y el folato séricos. Adecuadas concentraciones séricas de vitamina B12 disminuyen el riesgo de hiperhomocisteinemia en adultos24. Otros estudios nacionales llegan a la misma conclusión en el caso de los ancianos25.

La suplementación con ácido fólico y vitamina B12 reduce la concentración de homocisteína el 32 % en pacientes con enfermedad arterial coronaria y de forma más efectiva que la suplementación con vitamina B626,27.

En ocasiones, aunque la ingesta media de vitamina B12 se encuentre por encima de los valores diarios recomendados, hay una alta prevalencia de deficiencias séricas de ésta, especialmente en varones28.

El suplemento con vitamina B12 en pacientes ancianos con deficiencia en esta vitamina ha demostrado ser eficaz tras sólo 2 meses de terapia oral, seguro y aceptado por los pacientes29.

Por todo ello, el suplemento poblacional en nuestro país con vitaminas del grupo B podría estar justificado y más a la vista de los resultados de recientes estudios epidemiológicos en los que se muestra la inadecuada ingesta vitamínica, especialmente en niños y adolescentes30–32.

En el momento actual nos encontramos ante una pregunta de investigación aún no resuelta, por lo que es necesario seguir investigando para averiguar si un buen aporte de vitaminas del grupo B en la dieta resulta o no beneficioso en la prevención cardiovascular33.

Agradecimientos

Este proyecto forma parte de un proyecto más amplio denominado “Evaluación de las tendencias temporales en los hábitos alimentarios y en las variables antropométricas y metabólicas en niños. Seguimiento del Estudio Cuatro Provincias en la Comunidad de Madrid” que ha sido financiado por la Dirección General de Investigación de la Consejería de Educación de la Comunidad de Madrid.

BIBLIOGRAFÍA
[1.]
E. Joosten, A. Van den Berg, R. Riezler, H.J. Naurath, J. Lindenbaum, S.P. Stabler, et al.
Metabolic evidence that deficiencies of vitamin B-12 (cobalamin), folate, and vitamin B-6 occur commonly in elderly people.
Am J Clin Nutr, 58 (1993), pp. 468-476
[2.]
J. Lindenbaum, I.H. Rosenberg, P.W. Wilson, S.P. Stabler, R.H. Allen.
Prevalence of cobalamin deficiency in the Framingham elderly population.
Am J Clin Nutr, 60 (1994), pp. 2-11
[3.]
D.A. Bender.
Megaloblastic anaemia in vitamin B12 deficiency.
Br J Nutr, 89 (2003), pp. 439-441
[4.]
L. Van Goor, M.D. Woiski, A.M. Lagaay, A.E. Meinders, P.P. Tak.
Review: cobalamin deficiency and mental impairment in elderly people.
Age Ageing, 24 (1995), pp. 536-542
[5.]
D.Z. Van Asselt, L.C. De Groot, W.A. Van Staveren, H.J. Blom, R.A. Wevers, I. Biemond, et al.
Role of cobalamin intake and atrophic gastritis in mild cobalamin deficiency in older Dutch subjects.
Am J Clin Nutr, 68 (1998), pp. 328-334
[6.]
P.M. Ueland.
Homocysteine species as components of plasma redox thiol status.
Clin Chem, 41 (1995), pp. 340-342
[7.]
R.C. Pasternak, S.M. Grundy, D. Levy, P.D. Thompson.
27th Bethesda Conference: matching the intensity of risk factor management with the hazard for coronary disease events. Task Force 3. Spectrum of risk factors for coronary heart disease.
J Am Coll Cardiol, 27 (1996), pp. 978-990
[8.]
K.J. Harjai.
Potential new cardiovascular risk factors: left ventricular hypertrophy, homocysteine, lipoprotein(a), triglycerides, oxidative stress, and fibrinogen.
Ann Intern Med, 131 (1999), pp. 376-386
[9.]
P. Goyette, J.S. Sumner, R. Milos, A.M. Duncan, D.S. Rosenblatt, R.G. Matthews, et al.
Human methylenetetrahydrofolate reductase: isolation of cDNA, mapping and mutation identification.
Nat Genet, 7 (1994), pp. 195-200
[10.]
S.J. Dalmau, L.B. Ferrer, A.V. Modesto, D.M. Guillén, G.R. Vázquez, P.D. Corella, et al.
Concentración plasmática de homocisteína: relación con los niveles plasmáticos de ácido fólico y con el polimorfismo 677C → T de la 5,10-metilenotetrahidrofolato reductasa.
An Esp Pediatr, 56 (2002), pp. 409-415
[11.]
B. Fowler.
Disorders of homocysteine metabolism.
J Inherit Metab Dis, 20 (1997), pp. 270-285
[12.]
G.J. Hankey, J.W. Eikelboom.
Homocysteine and vascular disease.
[13.]
R.J. Lefkowitz, J.T. Willerson.
Prospects for cardiovascular research.
JAMA, 285 (2001), pp. 581-587
[14.]
P. Magnus, R. Beaglehole.
The real contribution of the major risk factors to the coronary epidemics: time to end the “only-50%” myth.
Arch Intern Med, 161 (2001), pp. 2657-2660
[15.]
M.Z. Gao, H.Q. Li.
[Vitamin B12 nutritional status in preschool children in Chongqing].
Zhonghua Er Ke Za Zhi, 44 (2006), pp. 7-10
[16.]
Ficha Técnica Folate Elecsys® Sistemas 2010/MODULAR ANALYTICS E170. 11820761. – 2001-07 – 1925369001 07 05. Roche Diagnostics GmbH, D-68298 Mannheim. 2001.
[17.]
R. Gibson.
Assessment of the status of folate and vitamin B12. Chapter 22.
Principles of Nutritional Assessment, pp. 461-483
[18.]
C. Papoutsakis, N. Yiannakouris, Y. Manios, E. Papaconstantinou, F. Magkos, K.H. Schulpis, et al.
Plasma homocysteine concentrations in Greek children are influenced by an interaction between the methylenetetrahydrofolate reductase C677T genotype and folate status.
J Nutr, 135 (2005), pp. 383-388
[19.]
J.I. Gutiérrez Revilla, H.F. Pérez, S.M. Tamparillas, M.T. Calvo Martín.
Influence of biochemical and genetic factors on homocysteine concentrations.
An Pediatr (Barc), 60 (2004), pp. 215-221
[20.]
R.M. Ras, C. Aulesa, J.J. Ortega.
Reference values for vitamin B12 in blood in a population of children and one of adults using the IMxRB12 method.
Sangre (Barc), 39 (1994), pp. 29-34
[21.]
H. Wetherilt, F. Ackurt, G. Brubacher, B. Okan, S. Aktas, S. Turdu.
Blood vitamin and mineral levels in 7-17 years old Turkish children.
Int J Vitam Nutr Res, 62 (1992), pp. 21-29
[22.]
B.I. Van, H.M. Den, C.M. Thomas, L. Afman, E.D. Oppenraay-van, H.J. Blom.
Total homocysteine and its predictors in Dutch children.
Am J Clin Nutr, 81 (2005), pp. 1110-1116
[23.]
H. Fakhrzadeh, S. Ghotbi, R. Pourebrahim, M. Nouri, R. Heshmat, F. Bandarian, et al.
Total plasma homocysteine, folate, and vitamin B12 status in healthy Iranian adults: the Tehran homocysteine survey (2003-2004)/a cross-sectional population based study.
BMC Public Health, 6 (2006), pp. 29
[24.]
P. Henríquez, J. Doreste, R. Deulofeu, M.D. Fiuza, L. Serra-Majem.
Nutritional determinants of plasma total homocysteine distribution in the Canary Islands.
Eur J Clin Nutr, 61 (2007), pp. 111-118
[25.]
C. Lasheras, J.M. Huerta, S. González, M. Prada, S. Braga, S. Fernández, et al.
Diet score is associated with plasma homocysteine in a healthy institutionalised elderly population.
Nutr Metab Cardiovasc Dis, 13 (2003), pp. 384-390
[26.]
B.J. Lee, M.C. Huang, L.J. Chung, C.H. Cheng, K.L. Lin, K.H. Su, et al.
Folic acid and vitamin B12 are more effective than vitamin B6 in lowering fasting plasma homocysteine concentration in patients with coronary artery disease.
Eur J Clin Nutr, 58 (2004), pp. 481-487
[27.]
K.S. Woo, P. Chook, L.L. Chan, A.S. Cheung, W.H. Fung, M. Qiao, et al.
Long-term improvement in homocysteine levels and arterial endothelial function after 1-year folic acid supplementation.
Am J Med, 112 (2002), pp. 535-539
[28.]
M.T. García-Arias, A. Villarino Rodríguez, M.C. García-Linares, A.M. Rocandio, M.C. García-Fernández.
Iron, folate and vitamins B12 and C dietary intake of an elderly institutionalized population in León, Spain.
Nutr Hosp, 18 (2003), pp. 222-225
[29.]
R. Rabuñal Rey, R. Monte Secades, M. Peña Zemsch, M. Bal Alvaredo, A. Gómez Gigirey.
Should we use oral replacement for vitamin B12 deficiency as the first option of treatment?.
Rev Clin Esp, 20 (2007), pp. 179-182
[30.]
L. Serra-Majem, L. Ribas-Barba, C. Pérez-Rodrigo, J.A. Bartrina.
Nutrient adequacy in Spanish children and adolescents.
Br J Nutr, 96 (2006), pp. S49-S57
[31.]
E. Planells, C. Sánchez, M.A. Montellano, J. Mataix, J. Llopis.
Vitamins B6 and B12 and folate status in an adult Mediterranean population.
Eur J Clin Nutr, 57 (2003), pp. 777-785
[32.]
A. Villarino Rodríguez, M.C. García-Linares, M.T. García-Arias, M.C. García-Fernández.
Anthropometric assessment and vitamin intake by a group of elderly institucionalized individuals in the province of Leon (Spain).
Nutr Hosp, 17 (2002), pp. 290-295
[33.]
M.J. Medrano, M.J. Sierra, J. Almazán, M.T. Olalla, G. López-Abente.
The association of dietary folate, B6, and B12 with cardiovascular mortality in Spain: An ecological analysis.
Am J Public Health, 90 (2000), pp. 1636-1638
Copyright © 2008. Asociación Española de Pediatría
Idiomas
Anales de Pediatría

Suscríbase a la newsletter

Opciones de artículo
Herramientas
es en

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

es en
Política de cookies Cookies policy
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here.